Home Favoritos Donativos RSS
counter

 
domingo, 20 de janeiro de 2008

Aulas de Biologia do MIT - lendo nas entrelinhas 4

dna, informaçãoNota da Lição:

Os geneticistas ficaram surpreendidos ao descobrir que alguns genes efectivamente se sobrepôem mutuamente, o que significa que o mesmo trecho de DNA pode estar envolvido na codificação de mais do que uma proteína. Isto é muito comum em procariontes, que têm menos DNA para embalar as suas instruções genéticas, mas descobriu-se que a mesma coisa ocorre também em eucariontes, que têm um genoma mais espaçoso.

Os meus pensamentos:

A disposição dos aminoácidos, que compôem a cadeia polipeptídea de proteínas , é codificada pelas moléculas dos ácidos nucleicos (nucleotídeos) no DNA. Estes nucleótidos vêm em 4 sabores, que são representadas pelas letras A T G e C. Uma série de 3 nucleótidos (um códão) codifica cada um dos aminoácidos. Assim, por exemplo, TAC codifica a tirosina, enquanto GAA codifica o glutamato. Deve notar-se que existem 64 combinações possíveis destes conjuntos de 3 nucleotídeos, enquanto existem apenas 20 aminoácidos, por isso muitos aminoácidos podem ser representados por mais de um códão, por exemplo, tanto o TAT como o TAC codificam a tirosina. Além disso, alguns conjuntos representam codões "iniciar" e codões "parar" (codões de iniciação e finalização) 1, que dão por terminado o gene e definem os "limites de leitura" - o gene está contido dentro desses limites de leitura.

Uma grande molécula conhecida como RNA polimerase lê o DNA e ajuda o RNA mensageiro a adquirir uma cópia do gene, que será traduzida para uma proteína noutro lugar. Ele lê o DNA nestes grupos de codões, começa no início da molécula DNA e lê ao longo dela em grupos de 3 nucleótidos; ele pode-se anexar em qualquer ponto e só começa o seu trabalho de transcrição quando se depara com o triplo ATG (o codão de iniciação). Portanto, em teoria, poderia haver um no início da fita de DNA, um a partir do 2º nucleótido da fita, um a partir do 3º nucleótido da fita, etc

Por exemplo, um trecho de DNA poderia ser algo como:

... ATGCATGTCATACCATAGCTAGAG ...

O ATG, no início iria começar a seqüência do gene e este terminaria logo que chegasse a um codão de finalização, que neste caso é a sequência TAG. Assim, o gene resultante constituido pelos limites de leitura mais 4 aminoácidos 2 seria algo como:

... ATG CAT GTC ATA CCA TAG CTA GAG ...

(Iniciação, histidina, valina, isoleucina, prolina, Finalização)

Mas calma aí: se olharmos para a seqüência original iremos notar que o codão ATG pode ser encontrado um pouco mais à frente, e que há outra TAG um pouco mais à frente também. Portanto, se nós ajustarmos o nosso ponto de partida apenas um pouco podemos encontrar um gene completamente diferente neste mesmo trecho de DNA, que é assim:

... A TGC ATG ACT TAC CAT AGC TAG AG ...

(Iniciação, serina, tirosina, histidina, serina, Finalização)

Estão a ver porque esta é uma descoberta tão surpreendente e interessante para os geneticistas? Isto é como descobrir que sua receita de tarte de frango também contém a receita para o detergente da lavandaria se fosse retirada todas as segundas letras da receita, ou que sua música favorita é também o hino nacional quando tocada da frente para trás. Já era suficientemente dificil explicar como novos genes poderiam ter aparecido através de mutações aleatórias; agora temos de explicar como é que genes tão delicadamente entrelaçados, poderiam ter surgido.

É um problema, quer se afirme que eles tenham aparecido gradualmente ou de uma vez só. Se você disser que genes sobrepostos apareceram juntos, então você apenas aumentou as improbabilidades estatísticas de equações que já eram problemáticas. Se você diz que isso aconteceu gradualmente (o primeiro gene apareceu e, em seguida, ocorreram ajustes para fazer o segundo entrar em cena), então você adicionou profundas limitações ao processo que se propõe a trazer os genes à existência. Uma coisa é dizer que um gene funcional poderia gradualmente e ao acaso ser construído em cima de um trecho de DNA não utilizado, mas dizer que ele pode aparecer por trás de um gene em funcionamento sem pôr em causa a sua função estica logo à partida o nivel de crença. Posso da mesma forma dizer que a minha mulher pode mudar lentamente a sua receita de tarte para uma receita de crypto-detergente sem fazer o meu filho vomitar a determinada altura, de tal maneira que ela o faz, e lhe serve o produto.

Notas finais:

1. O códão de iniciação ATG codifica o aminoácido metionina. Os três codões de finalização, TAA, TAG, e TGA, não codificam um aminoácido real.

2. Como você deve se lembrar de uma Nota de Lição anterior, a proteína média é constituída por pelo menos 150 aminoácidos.

(Texto a azul, por Paul Pruett)

0 comentários:

Postar um comentário





Related Posts with Thumbnails
A origem da vida não é consensual. A evolução dos seres vivos não é consensual. A teoria de Lamarck, a teoria de Darwin, e outras, propuseram a transformação dos seres vivos ao longo do tempo.

Mas o evolucionismo e o darwinismo não explicam de forma satisfatória a complexidade dos seres vivos. A biologia molecular e a biologia celular revelam mecanismos cuja origem os darwinistas nem se atrevem a tentar explicar.


Este blog trata de Design Inteligente, Darwinismo e Teoria da Evolução